View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13402_high_25 (Length: 338)
Name: NF13402_high_25
Description: NF13402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13402_high_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 20 - 212
Target Start/End: Complemental strand, 35508179 - 35507987
Alignment:
| Q |
20 |
atggggggttcggtgcgagacgtgaagtcaaagtcggagttggatgaggttgttcgcggcggttctccggcggtgcttcacttctgggcgtcatggtgtg |
119 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35508179 |
atgggtggttcggtgcgagacgtgaagtcaaagtcggagttggatgaggtggttcgcggcggttctccggcggtgcttcacttctgggcgtcatggtgtg |
35508080 |
T |
|
| Q |
120 |
aagcttccaaacacatggaccaactcttctctcatttggccattgatttccctcatacccatttcttaagggttcggttttctttcccaatta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35508079 |
aagcttccaaacacatggaccaactcttctctcatttggccattgatttccctcatacccatttcttaagggttcggttttctttcccaatta |
35507987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 279 - 331
Target Start/End: Complemental strand, 35507920 - 35507868
Alignment:
| Q |
279 |
ggttgaagctgaagaacaaccagagatatctgaggcttattctgtctctgctg |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35507920 |
ggttgaagctgaagaacaaccagagatatctgaggcttattctgtctctgctg |
35507868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University