View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13402_high_37 (Length: 320)
Name: NF13402_high_37
Description: NF13402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13402_high_37 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 23 - 320
Target Start/End: Complemental strand, 39775727 - 39775430
Alignment:
| Q |
23 |
atcatcagacaagaagattattggtataaatcattttcatgatgatttattcaaaggaactttgttgggttgggtatccaaataatgcagcacaattgca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39775727 |
atcatcagacaagaagattattggtataaatcattttcatgatgatttattcaaaggaactttgttgggttgggtatccaaataatgcagcacaattgca |
39775628 |
T |
 |
| Q |
123 |
caaacatttcatgtccatcgatccatcaaataaggactaccccacaaaataaaaccattgctattatttttgttttcaatgatcaatccaacaagagaca |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39775627 |
caaacatttcatgtccatcgatccatcaaataaggactaccccacaaaataaaaccattgctattatttttgttttcaatgatcaatccaacaagggaca |
39775528 |
T |
 |
| Q |
223 |
actcaaaatagattgaaaggcattataacgacaagagcatgataccttaaagtagagtacggtcatgcttaattaaacatcgcttgtaagatcaaaat |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39775527 |
actcaaaatagattgaaaggcattataacgacaagagcatgataccttaaagtagagtacggtcatgcttaattaaacatcgcttgtaagatcaaaat |
39775430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University