View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13404_high_9 (Length: 323)
Name: NF13404_high_9
Description: NF13404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13404_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 10379508 - 10379663
Alignment:
| Q |
1 |
ctatgttaataatacaatattgatttaactagatataatatggcttatttataaatatattgcatttttccgttatatttaataggatagtgttttttga |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10379508 |
ctatgttaatagtacaatattgatttaactagatataatatggcttatttataaatatattgcatttttccgttatatttattaggatagtgttttttga |
10379607 |
T |
|
| Q |
101 |
atttgcatcgctcgcattgccctcagcgagcctctgacctagtgttaaattgttgc |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10379608 |
atttgcatcgctcgcattgccctcagcgagcctctgaactagtgttaaattgttgc |
10379663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 191 - 300
Target Start/End: Original strand, 10379691 - 10379800
Alignment:
| Q |
191 |
ccaactgagagtcagggtggagaagccagttccatatggccatctgatggaaaactgcattctgttgcaactcaaaacactctccgatgcctctctcgta |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10379691 |
ccaactgagagtcagggtggagaagccagttccatatggccatctgatggaaaactgcattctgttgcaactcaaaacactctccgatgcctctctcgta |
10379790 |
T |
|
| Q |
291 |
tgcttgatga |
300 |
Q |
| |
|
|||||||||| |
|
|
| T |
10379791 |
tgcttgatga |
10379800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University