View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13406_high_5 (Length: 221)
Name: NF13406_high_5
Description: NF13406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13406_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 209
Target Start/End: Complemental strand, 45845929 - 45845738
Alignment:
| Q |
18 |
gtttttcatcacaatgtttcaaacaatggaaatcacttcttaatttagctgtaccaagttgtctttctgtttgccttgaatggtggtggtatgaaatcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45845929 |
gtttttcatcacaatgtttcaaacaatggaaatcacttcttaatttagctgtaccaagttgtctttctgtttgccttgaatggtggtggtatgaaatcat |
45845830 |
T |
 |
| Q |
118 |
gatcttgttatgtggtttgttgataaatccaagagcaaccgttgcttctatgggaattttgattcaaactacttctttgctatatatttttc |
209 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45845829 |
gattttgttatgtggtttgttgataaatccaagagcaaccgttgcttctatgggaattttgattcaaactacttctttgctatatatttttc |
45845738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 32 - 209
Target Start/End: Original strand, 2990338 - 2990515
Alignment:
| Q |
32 |
tgtttcaaacaatggaaatcacttcttaatttagctgtaccaagttgtctttctgtttgccttgaatggtggtggtatgaaatcatgatcttgttatgtg |
131 |
Q |
| |
|
||||||||| ||||||||| ||| | |||||||| | ||||| || |||| ||||| || |||||||||||||| ||||||||||| ||| | |||| |
|
|
| T |
2990338 |
tgtttcaaaggatggaaatcgcttttgaatttagcaattccaagctgcatttcggtttgtctcgaatggtggtggtacgaaatcatgattttgctttgtg |
2990437 |
T |
 |
| Q |
132 |
gtttgttgataaatccaagagcaaccgttgcttctatgggaattttgattcaaactacttctttgctatatatttttc |
209 |
Q |
| |
|
| || ||| | |||||| ||||| ||||| |||||||| | ||||||||||| ||| | ||| |||| ||||||| |
|
|
| T |
2990438 |
gattattgcttaatccacatgcaactgttgcatctatgggtgtgttgattcaaaccactgcattgatatacatttttc |
2990515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University