View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13407_high_11 (Length: 204)
Name: NF13407_high_11
Description: NF13407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13407_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 186
Target Start/End: Original strand, 22517219 - 22517387
Alignment:
| Q |
18 |
atcattccactttggtcaccagaaacaaggcgaagagagttgatgtcaaaatataatactgtcaagggaacaccacttaaagaatgatcaattttactct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22517219 |
atcattccactttggtcaccagaaacaaggcgaagagagttgatgtcaaaatataatactgtcaagggaacaccacttaaagaatgatcatttttactct |
22517318 |
T |
|
| Q |
118 |
gctgctttaattgcaaaactgtgatgaagaaggggcctgatgcatcccaaaaagttatggctccattat |
186 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
22517319 |
gctgctttaattgcaaacctgtgatgaagaagggacctgatgcatcccaaaaagttatgcctccattat |
22517387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 20 - 119
Target Start/End: Original strand, 9709941 - 9710040
Alignment:
| Q |
20 |
cattccactttggtcaccagaaacaaggcgaagagagttgatgtcaaaatataatactgtcaagggaacaccacttaaagaatgatcaattttactctgc |
119 |
Q |
| |
|
||||||||| |||||||||||||| ||| ||||||| |||||||||||||||||| ||||||| || |||||||||||||| |||||| ||| ||||||| |
|
|
| T |
9709941 |
cattccactctggtcaccagaaaccaggagaagagacttgatgtcaaaatataattctgtcaatggtacaccacttaaagattgatcattttcactctgc |
9710040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 116 - 186
Target Start/End: Original strand, 9710354 - 9710424
Alignment:
| Q |
116 |
ctgctgctttaattgcaaaactgtgatgaagaaggggcctgatgcatcccaaaaagttatggctccattat |
186 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| | ||||||||||||||| |||||||||||||||| |
|
|
| T |
9710354 |
ctgctgctttaattgcaaaactgggatgaagaagggacatgatgcatcccaaaatgttatggctccattat |
9710424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University