View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13407_high_2 (Length: 464)
Name: NF13407_high_2
Description: NF13407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13407_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 2e-71; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 246 - 418
Target Start/End: Original strand, 14431097 - 14431269
Alignment:
| Q |
246 |
gttttcgtccccagagctttgactttttcgccgaatttgtaagagaggtttaagttccctttagctttccccgaagacgttctaacctgataattaacca |
345 |
Q |
| |
|
|||||| || || |||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
14431097 |
gttttcatcgccggagcttggactttttcgccgaatttgtaagagaggtttaagtttcctttagctttccctgaagatgttctaacctgataattaacct |
14431196 |
T |
|
| Q |
346 |
gccggaaagaatctccggaggtgttatcaagaagctccttgagagggatatgaaccttgccgatcaaggtatc |
418 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14431197 |
gccggaaagaatctccggaggggttatcaagaagctccttgagagggatatgaaccttgccgatcaaggtatc |
14431269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 140 - 246
Target Start/End: Original strand, 14430946 - 14431052
Alignment:
| Q |
140 |
tggatatccataaaccggttgttgcagctgaggaggataaggtgtaccatacggcaccgagctagaccccgctgccgccattccaggtggaggataagcc |
239 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14430946 |
tggatatccataacccggttgttgcggctgaggaggataaggtgtaccatacggcaccgagctagacccagctgccgccattccaggtggaggataagcc |
14431045 |
T |
|
| Q |
240 |
atcaccg |
246 |
Q |
| |
|
||||||| |
|
|
| T |
14431046 |
atcaccg |
14431052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 123 - 164
Target Start/End: Original strand, 14430734 - 14430775
Alignment:
| Q |
123 |
ttctgtgcttctgccactggatatccataaaccggttgttgc |
164 |
Q |
| |
|
|||||||||| |||| |||||||||||||| ||||||||||| |
|
|
| T |
14430734 |
ttctgtgcttgtgcccctggatatccataacccggttgttgc |
14430775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University