View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13407_low_8 (Length: 244)
Name: NF13407_low_8
Description: NF13407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13407_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 132 - 239
Target Start/End: Complemental strand, 53108010 - 53107903
Alignment:
| Q |
132 |
gggttacaggaagttcttctcttccctgccatgaaacctcaagatgtaccttcaactaaaggtttgtattgtacatgcattccccttcttttcattgaaa |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53108010 |
gggttacaggaagttcttctcttccctgccatgaaacctcaagatgtaccttcaactaaaggtttgtattgtacatgcattccccttcttttcattgaaa |
53107911 |
T |
 |
| Q |
232 |
attaatgt |
239 |
Q |
| |
|
|||||||| |
|
|
| T |
53107910 |
attaatgt |
53107903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 133 - 223
Target Start/End: Complemental strand, 53125799 - 53125709
Alignment:
| Q |
133 |
ggttacaggaagttcttctcttccctgccatgaaacctcaagatgtaccttcaactaaaggtttgtattgtacatgcattccccttctttt |
223 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||||| ||||||||||||| ||||||||| ||| ||||||||| |
|
|
| T |
53125799 |
ggttacaggaagttattctcttccatgccatgaaacctcaagatgtaccttcagctaaaggtttgtaatgtacatgccttcaccttctttt |
53125709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 21 - 62
Target Start/End: Complemental strand, 53108121 - 53108080
Alignment:
| Q |
21 |
atcggttgacaatgatactgactgattcacagaatatcaagg |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53108121 |
atcggttgacaatgatactgactgattcacagaatatcaagg |
53108080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 133 - 178
Target Start/End: Original strand, 15841708 - 15841753
Alignment:
| Q |
133 |
ggttacaggaagttcttctcttccctgccatgaaacctcaagatgt |
178 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15841708 |
ggttacaggaggttcttctcttccctgccatgaaacctcaagatgt |
15841753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University