View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13408_low_3 (Length: 489)
Name: NF13408_low_3
Description: NF13408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13408_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 4e-64; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 4e-64
Query Start/End: Original strand, 355 - 479
Target Start/End: Complemental strand, 27469984 - 27469860
Alignment:
| Q |
355 |
atttaggatgatatgaagagttttgtgaatgaagggttgagagtgttgcttcatggaaagagtatagtggtggaagattatttggatacaaggtgggaag |
454 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27469984 |
atttaggatgatatgaagagttttgtgaatgaagggttgagagtgttgcttcatggaaagagtatagtggtggaagattatttggatacaaggtgggaag |
27469885 |
T |
 |
| Q |
455 |
aggttactggagaggttgttgatga |
479 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
27469884 |
aggttactggagaggttgttgatga |
27469860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 171 - 290
Target Start/End: Complemental strand, 27470160 - 27470041
Alignment:
| Q |
171 |
caatggtgtctcttctcgttgcaacaacatccgaccctgcttcaatcaaccctgccaatgccctcttagccatgctaggctggcaacctggactccattt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||| |
|
|
| T |
27470160 |
caatggtgtctcttctcgttgcaacaacatccgaccctgcttcaatcaaccctgccaatgccctcttagccatgccaggttggcaacctggaccccattt |
27470061 |
T |
 |
| Q |
271 |
cgaggttcaaccaaaaaccc |
290 |
Q |
| |
|
| |||||||||||||||||| |
|
|
| T |
27470060 |
ccaggttcaaccaaaaaccc |
27470041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 19 - 121
Target Start/End: Complemental strand, 27470312 - 27470210
Alignment:
| Q |
19 |
gtacatgacatgacatgacatgttgcttagtacaatagttcgttcctgtccaatagtaaaccactcccgccaccccttttttcacctaaaccgcagcctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27470312 |
gtacatgacatgacatgacatgttgcttagtacaatagttcgttcctgtccaatagtaaaccactcccgccaccccttttttcacctaaaccgcagcctt |
27470213 |
T |
 |
| Q |
119 |
aga |
121 |
Q |
| |
|
||| |
|
|
| T |
27470212 |
aga |
27470210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University