View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13409_high_13 (Length: 327)
Name: NF13409_high_13
Description: NF13409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13409_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 8 - 139
Target Start/End: Complemental strand, 34397551 - 34397419
Alignment:
| Q |
8 |
ccaagaatatcctacttagtttggatcggttgattcaattgcttatgaaacaacttcatatttttt-aagatggaatgaattcaaaagtaatacatcaaa |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34397551 |
ccaataatatcctacttagtttggatcggttgattcaattgcttatgaaacaacttcatatttttttaagatggaatgaattcaaaagtaatacatcaaa |
34397452 |
T |
 |
| Q |
107 |
atacctctaaattttcaacttacatagatttgc |
139 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||| |
|
|
| T |
34397451 |
atacctttaaattttcaacttacataaatttgc |
34397419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 223 - 311
Target Start/End: Complemental strand, 34397328 - 34397237
Alignment:
| Q |
223 |
aatgaaatacattcttagtaaacttata---atgagtatgtgcaatgcgaattgaatcctctcattttatctttctcatccattctttaatt |
311 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34397328 |
aatgaaatacagtcttagtaaacttatagtaattagtatgtgcaatgcgaattgaattctctcattttatctttctcatccattctttaatt |
34397237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University