View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13409_low_17 (Length: 278)
Name: NF13409_low_17
Description: NF13409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13409_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 52000979 - 52000780
Alignment:
| Q |
1 |
ggtttgaaggagagtgcagaattgcgacatgaatcctggttgtattgttgcagccgaggatgttaggagagtagacgagtttctatatatggttgccctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52000979 |
ggtttgaaggagagtgcagaattgcgacatgaatcctggttgtattgttgcagccgaggatgttaggagagtagacgagtttctatatatggttgccctc |
52000880 |
T |
|
| Q |
101 |
gtgtgatcatcggtgtgataggcttaacagagatggtgtatacaaaggaggtaatattggtatggaggaagtagccattcgtattgggagattaaatatt |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52000879 |
gtgtgatcatcagtgtgataggcttaacagagatggtgtatacaaaggaggtaatattggtatggaggaagtagccattcgtattgggagattaaatatt |
52000780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 208 - 261
Target Start/End: Original strand, 52001161 - 52001216
Alignment:
| Q |
208 |
atgctttcttctgggtgtttatgcact--tatatttaagaatactagtatggcact |
261 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
52001161 |
atgctttcttctgggtgtttatgcacttatatatgtaagaatactagtatggcact |
52001216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University