View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13409_low_19 (Length: 240)
Name: NF13409_low_19
Description: NF13409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13409_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 225
Target Start/End: Original strand, 2504340 - 2504547
Alignment:
| Q |
18 |
aacaattatggtggaaaagtgggcattagattattgttttactataataatcagatagagacaagccatgctgattagtggttactaatccatcacaaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2504340 |
aacaattatggtggaaaagtgggcattagatcattggtttactataataatcagatagagacaagccatgctgattagtggttactaatccatcacaaat |
2504439 |
T |
|
| Q |
118 |
aaggaggaagaggtagtagatccaaaagatcaatagatagtgtagtacagaatccaaaagctttgctagatttggaaactgtcttttttaataatgacta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2504440 |
aaggaggaagaggtagtagatccaaaagatcaatagatagtgtagtacagaatccaaaagctttgctagatttggaaactgtcttttttaataatgacta |
2504539 |
T |
|
| Q |
218 |
gtgttgat |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
2504540 |
gtgttgat |
2504547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University