View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13409_low_21 (Length: 223)
Name: NF13409_low_21
Description: NF13409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13409_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 24384009 - 24384216
Alignment:
| Q |
1 |
caataaaagaaggcttggatttgggaccgaaaaatatcttatcaacataatannnnnnnnnnnggtacaatatcaacataaaatttaatttatggatnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
24384009 |
caataaaagaaggcttggatttgggaccgaaaaatatcttatcaacataatatttttttttt-ggtacaatatcaacataaaatttaatttatggataaa |
24384107 |
T |
 |
| Q |
101 |
nnnncataaatataatttaatagttaattaatttgtttcaaataaaatccaaccaataacctttcagaaaattccatcgaaaaataatatttgtttaggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24384108 |
aaaacataaatataatttaatagttaattaatttgtttcaaataaaatccaaccaataaccttttagaaaattccatcgaaaaataatatttgtttaggg |
24384207 |
T |
 |
| Q |
201 |
ttcaagttg |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
24384208 |
ttcaagttg |
24384216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University