View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13409_low_9 (Length: 396)
Name: NF13409_low_9
Description: NF13409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13409_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 1 - 380
Target Start/End: Complemental strand, 26275824 - 26275445
Alignment:
| Q |
1 |
aggacttggatagaacgtaatgatagatatttcaataataatgcgcattcgatggaacatctgtttcggagtgttattgtggaagtaggctgtagcttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26275824 |
aggacttggatagaacgtaatgatagatatttcaataataatgcgcattcgatggaacatctgtttcggagtgttattgtggaagtaggctgtagcttca |
26275725 |
T |
 |
| Q |
101 |
acataattcaagcttctaaatctgctatgctggatgccaaattatcacatctgtttgacctatatctgagctggcatttataaaggaaaaattggatgcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
26275724 |
acataattcaagcttctaaatctgctatgctggatgccaaattatcacatctgtttgacctatatctgagctggcatttataaaggaaaaattggatact |
26275625 |
T |
 |
| Q |
201 |
aacttaaacttgcaaatgacaatgaagaattgggatggctagaaacttgtattcacgtgctcttggatcacaactcaatgttgcaaatataaattgcggc |
300 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26275624 |
aacataaacttgcaaatgacaatgaagaattgggttggctagaaacttgtattcacgtgctcttggatcacatctcaatgttgcaaatataaattgcggc |
26275525 |
T |
 |
| Q |
301 |
gactgcaatcgtagcacttcgatacaggtacgatacattgcatgtaactgttgagacatttaagttttagatgtacatca |
380 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
26275524 |
gactgcaatcgtagcgcttcgatacaggtacgatgcattgcatgtaactgttgagacattgaagttttagatctacatca |
26275445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University