View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1340_high_4 (Length: 323)
Name: NF1340_high_4
Description: NF1340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1340_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 28638965 - 28639237
Alignment:
| Q |
1 |
tggaatggtccaaaaagaatctctacttttgaaaaggtgaataaaacaactgacaaagaaatacatctaggtggttttggtatcactgccaaactctatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28638965 |
tggaatggtccaaaaagaatctctacttttgaaaaggtgaataaaacaactgacaaagaaatacatctaggtggttttggtatcactgccaaactctatt |
28639064 |
T |
|
| Q |
101 |
ttgcagcaagcataa--ttattttannnnnnnnattacagtaaaagcaaaatcagtagcacaaggaactataagtgagtcagtgtgacataatctgaaaa |
198 |
Q |
| |
|
||||||||||||||| || |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28639065 |
ttgcagcaagcataattttttttttttttttttattacagtaaaagcaaaatcagtagcacaaggaactataagtgagtcagtgtgacataatctgaaaa |
28639164 |
T |
|
| Q |
199 |
ttgtcaataaagttatgagtgccttatnnnnnnntcagcgaccacaacgtcagttaattttgtccatatcagt |
271 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28639165 |
ttgtcaataaagttatgagtgccttataaaaaaatccgcgaccacaacgtcagtttattttgtccatatcagt |
28639237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University