View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1340_low_12 (Length: 268)
Name: NF1340_low_12
Description: NF1340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1340_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 29 - 220
Target Start/End: Complemental strand, 43802385 - 43802188
Alignment:
| Q |
29 |
aatatccaagtaacttaactttgacaaatcattttcttctactaatttcttcgccccaaccacgttatctagctcttgttggagatttttcatcactctt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43802385 |
aatatccaagtaacttaactttgacaaatcattttcttctactaatttgttcgccccaaccacgttatctagctcttgttggagatttttcatcactctt |
43802286 |
T |
|
| Q |
129 |
ggatgcctcatgagctctgacaaagccc------tagctgttgcggaagtttcaaatgccccggcaatcatgtctagggatatagcctttatgtttgt |
220 |
Q |
| |
|
|||||||||||||||||||| ||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43802285 |
ggatgcctcatgagctctgataaagcccactccacaaccgttgcggaagtttcaaatgccccggcaatcatgtctagggatatagcctttatgtttgt |
43802188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 29 - 220
Target Start/End: Complemental strand, 43812954 - 43812757
Alignment:
| Q |
29 |
aatatccaagtaacttaactttgacaaatcattttcttctactaatttcttcgccccaaccacgttatctagctcttgttggagatttttcatcactctt |
128 |
Q |
| |
|
|||||| |||||||||||||||| || |||||| || || |||||||| ||| |||||| || |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
43812954 |
aatatctaagtaacttaactttgccatatcattctcctccactaatttgttcatcccaactacactatccagctcttgttggagatttttcattactctt |
43812855 |
T |
|
| Q |
129 |
ggatgcctcatgagctctgacaaagccc------tagctgttgcggaagtttcaaatgccccggcaatcatgtctagggatatagcctttatgtttgt |
220 |
Q |
| |
|
||||||||||||||||| || ||||||| | ||||| ||||| ||||||||| |||| |||||||||| || |||||||||||||||||| |
|
|
| T |
43812854 |
ggatgcctcatgagctcggataaagcccactccacaatggttgcagaagtgtcaaatgccgcggcgatcatgtctaaggctatagcctttatgtttgt |
43812757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University