View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1340_low_17 (Length: 251)
Name: NF1340_low_17
Description: NF1340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1340_low_17 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 16 - 251
Target Start/End: Original strand, 50963970 - 50964205
Alignment:
| Q |
16 |
ataaaacattgaaaattcatagtttggttggaagctnnnnnnngttagccagatgttgttatagttaggatcgaacttggatacccccgatataatttgc |
115 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50963970 |
ataaaatattgaaaattcatagtttggttggaagctaaaaaaagttagccagatgttgttatagttaggatcgaacttggatacccccgatataatttgc |
50964069 |
T |
|
| Q |
116 |
ttaatcgaaagttgaacgtccaagtaggtagctagattggtgaccataaagaaattttaaacaaggaggtgcagggttcaaaaaactagcatcatatgtt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50964070 |
ttaatcgaaagttgaacgtccaagtaggtagctagattggtgaccataaagaaattttaaacaaggaggtgcagggttcaaaaaactagcatcatatgtt |
50964169 |
T |
|
| Q |
216 |
cacgannnnnnncgaacagtacatgaatttgcaaca |
251 |
Q |
| |
|
||||| |||||||||||||||||||||||| |
|
|
| T |
50964170 |
cacgatttttttcgaacagtacatgaatttgcaaca |
50964205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University