View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1340_low_19 (Length: 241)
Name: NF1340_low_19
Description: NF1340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1340_low_19 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 20 - 241
Target Start/End: Complemental strand, 10562844 - 10562621
Alignment:
| Q |
20 |
gtttatctatgttt-gtttaatgcaagaaatgttaactatttttgattgttatacataccatagttggtacctgtggctctttgttgtgctctttttgct |
118 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10562844 |
gtttatctatgttttgtttaatgcaagaaacgttaacttttcttgattgttatacataccatagttggtacctgtggctctttgttgtgctttttttgct |
10562745 |
T |
 |
| Q |
119 |
gttgaatcttgaaggtaaaccaatgattctctttagcaatgttttatttgacaatgacatattagaat-tacctactgatatgagtttactatatgtagg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
10562744 |
gttgaatcttgaaggtaaaccaatgattctctttagcaatgttttatttaacaatgacattttagaatctacctactgatatgagtttactatatgcagg |
10562645 |
T |
 |
| Q |
218 |
gtgtcacacttatttctggttagc |
241 |
Q |
| |
|
||| |||||||||||||||||||| |
|
|
| T |
10562644 |
gtggcacacttatttctggttagc |
10562621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University