View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1341-Insertion-16 (Length: 181)
Name: NF1341-Insertion-16
Description: NF1341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1341-Insertion-16 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 76 - 181
Target Start/End: Original strand, 43449892 - 43449997
Alignment:
| Q |
76 |
gtaaccacgccgaagaatctgccatcattctcctcagaatctttcattccaatccttcactcgctcgatctgaaatagcaccgtctctctacgagcatct |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43449892 |
gtaaccacgccgaagaatctgccatcattctcctcagaatctttcattccaatccttcactcgctcgatctgaaatagcaccgtctctctacgagcatct |
43449991 |
T |
|
| Q |
176 |
tttttg |
181 |
Q |
| |
|
|||||| |
|
|
| T |
43449992 |
tttttg |
43449997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University