View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1341-Insertion-19 (Length: 95)
Name: NF1341-Insertion-19
Description: NF1341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1341-Insertion-19 |
 |  |
|
| [»] chr3 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 4e-38; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 4e-38
Query Start/End: Original strand, 8 - 95
Target Start/End: Original strand, 3075623 - 3075710
Alignment:
| Q |
8 |
cattttgtcaattttgtgtctctactgctgcttcagatattcttcaacactgtcctaatagagcttcagctgttatatggtacaactt |
95 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3075623 |
cattttgtcaattttgtgtctccactgctgcctcagatattcttcaacactgtcctaatagagcttcagctgttatatggtacaactt |
3075710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 76; E-Value: 1e-35
Query Start/End: Original strand, 8 - 95
Target Start/End: Original strand, 3086164 - 3086251
Alignment:
| Q |
8 |
cattttgtcaattttgtgtctctactgctgcttcagatattcttcaacactgtcctaatagagcttcagctgttatatggtacaactt |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3086164 |
cattttgtcaattttgtgtctctactgctgcttcagatgttcttcagcgctgtcctaatagagcttcagctgttatatggtacaactt |
3086251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 8 - 90
Target Start/End: Complemental strand, 4555548 - 4555466
Alignment:
| Q |
8 |
cattttgtcaattttgtgtctctactgctgcttcagatattcttcaacactgtcctaatagagcttcagctgttatatggtac |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| || ||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
4555548 |
cattttgtcaattttgtgtctctactgctgcctcatatgttcttcagtactgtcctaatagagcctcagctgttatatggtac |
4555466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University