View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1341-Insertion-20 (Length: 91)
Name: NF1341-Insertion-20
Description: NF1341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1341-Insertion-20 |
 | |
|
| [»] chr2 (3 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 9e-36; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 9e-36
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 9029293 - 9029210
Alignment:
| Q |
8 |
cacccctttcacatcatcaaagttcttatcctgatgctgttcaattacaagcctctattattgccccgctaccatcgtcatcat |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9029293 |
cacccctttcacatcatcaaagttcttatcctgatgctgttcaattacaagcctctattcgtgccccgctaccatcgtcatcat |
9029210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 2e-33
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 9007396 - 9007313
Alignment:
| Q |
8 |
cacccctttcacatcatcaaagttcttatcctgatgctgttcaattacaagcctctattattgccccgctaccatcgtcatcat |
91 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9007396 |
cacctctttcacatcatcaaagttcttatcctgatgctgttcaattacaagcctctattcgtgccccgctaccatcgtcatcat |
9007313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 68; E-Value: 6e-31
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 8994636 - 8994553
Alignment:
| Q |
8 |
cacccctttcacatcatcaaagttcttatcctgatgctgttcaattacaagcctctattattgccccgctaccatcgtcatcat |
91 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8994636 |
caccccttgcacatcatcaaagttcttatcctgatgctcttcaattacaagcctctattcgtgccccgctaccatcgtcatcat |
8994553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University