View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1341-Insertion-21 (Length: 81)

Name: NF1341-Insertion-21
Description: NF1341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1341-Insertion-21
NF1341-Insertion-21
[»] chr8 (7 HSPs)
chr8 (8-81)||(6368940-6369013)
chr8 (8-81)||(6389922-6389995)
chr8 (34-79)||(6409173-6409218)
chr8 (20-81)||(6273491-6273552)
chr8 (45-81)||(6362165-6362201)
chr8 (34-81)||(6320370-6320417)
chr8 (34-81)||(6330832-6330879)


Alignment Details
Target: chr8 (Bit Score: 74; Significance: 1e-34; HSPs: 7)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 74; E-Value: 1e-34
Query Start/End: Original strand, 8 - 81
Target Start/End: Complemental strand, 6369013 - 6368940
Alignment:
8 gaagactgataagtgggttaaattggaaactcgtacagagttgattgaaacttgcaccaccctcatatggattg 81  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6369013 gaagactgataagtgggttaaattggaaactcgtacagagttgattgaaacttgcaccaccctcatatggattg 6368940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 74; E-Value: 1e-34
Query Start/End: Original strand, 8 - 81
Target Start/End: Complemental strand, 6389995 - 6389922
Alignment:
8 gaagactgataagtgggttaaattggaaactcgtacagagttgattgaaacttgcaccaccctcatatggattg 81  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6389995 gaagactgataagtgggttaaattggaaactcgtacagagttgattgaaacttgcaccaccctcatatggattg 6389922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.0000000000004
Query Start/End: Original strand, 34 - 79
Target Start/End: Complemental strand, 6409218 - 6409173
Alignment:
34 aaactcgtacagagttgattgaaacttgcaccaccctcatatggat 79  Q
    |||||||| ||||||||||||||||||||||||||||||| |||||    
6409218 aaactcgtgcagagttgattgaaacttgcaccaccctcatttggat 6409173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.00000000009
Query Start/End: Original strand, 20 - 81
Target Start/End: Complemental strand, 6273552 - 6273491
Alignment:
20 gtgggttaaattggaaactcgtacagagttgattgaaacttgcaccaccctcatatggattg 81  Q
    |||||||||  || ||||||| ||||||||||||||  ||||||| ||||||||||||||||    
6273552 gtgggttaagatgcaaactcgcacagagttgattgactcttgcactaccctcatatggattg 6273491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.0000000004
Query Start/End: Original strand, 45 - 81
Target Start/End: Complemental strand, 6362201 - 6362165
Alignment:
45 gagttgattgaaacttgcaccaccctcatatggattg 81  Q
    |||||||||||| ||||||||||||||||||||||||    
6362201 gagttgattgaagcttgcaccaccctcatatggattg 6362165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 34 - 81
Target Start/End: Complemental strand, 6320417 - 6320370
Alignment:
34 aaactcgtacagagttgattgaaacttgcaccaccctcatatggattg 81  Q
    ||||| ||||||||||||||||| ||||||| | ||||||||||||||    
6320417 aaacttgtacagagttgattgaagcttgcactatcctcatatggattg 6320370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 32; E-Value: 0.000000001
Query Start/End: Original strand, 34 - 81
Target Start/End: Complemental strand, 6330879 - 6330832
Alignment:
34 aaactcgtacagagttgattgaaacttgcaccaccctcatatggattg 81  Q
    ||||| ||||||||||||||||| ||||||| | ||||||||||||||    
6330879 aaacttgtacagagttgattgaagcttgcactatcctcatatggattg 6330832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University