View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1341-Insertion-9 (Length: 307)
Name: NF1341-Insertion-9
Description: NF1341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1341-Insertion-9 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 7 - 307
Target Start/End: Complemental strand, 12313864 - 12313554
Alignment:
| Q |
7 |
aacatgttttacatcaacaatatgtgtaaattaaactatatggttatttcatctatttcaaattttaagcttttgttgtcctgaaatacaattttacggc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
12313864 |
aacatgttttacatcaacaatatgtgtaaattaaactctacggttatttcatctatttcaaattttaagcttttgttgtccagaaatacaattttatggc |
12313765 |
T |
|
| Q |
107 |
tttagctattaattgtgatggctttttaggtggtccatcaattatttattctatgtta----------agnnnnnnntatcttgcttatcactttgccaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
12313764 |
tttagctattaattgtgatggctttttaggtggtccatcaattatttattctatgttaatatccaaacagaaaaaaatatcttgcttatcactttgccaa |
12313665 |
T |
|
| Q |
197 |
ttatagcctaaattgatttttacgaagttggctatatgtttgtgtttatttaggaatacaaaatgggactatatactacaaaatcatgtgacttaggtgt |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12313664 |
ttatagcctaaattgatttttacgaagttggctatatgattgtgtttatttaggaatacaaaatgggactatatactacaaaatcatgtgacttaggtgt |
12313565 |
T |
|
| Q |
297 |
ttgcttacgta |
307 |
Q |
| |
|
||||||||||| |
|
|
| T |
12313564 |
ttgcttacgta |
12313554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University