View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13411_high_9 (Length: 310)

Name: NF13411_high_9
Description: NF13411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13411_high_9
NF13411_high_9
[»] chr2 (1 HSPs)
chr2 (39-130)||(4311041-4311132)


Alignment Details
Target: chr2 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 39 - 130
Target Start/End: Original strand, 4311041 - 4311132
Alignment:
39 ctacgagtgtaactagaactagctgcaaaactgggtccgtccagctctttactcattcacaactgataacttatatgcaatatatgtaccaa 130  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4311041 ctacgagtgtaactagaactagctgcaaaactgggtccgtccagctctttactcattcacaactgataacttatatgcaatatatgtaccaa 4311132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University