View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13411_high_9 (Length: 310)
Name: NF13411_high_9
Description: NF13411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13411_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 39 - 130
Target Start/End: Original strand, 4311041 - 4311132
Alignment:
| Q |
39 |
ctacgagtgtaactagaactagctgcaaaactgggtccgtccagctctttactcattcacaactgataacttatatgcaatatatgtaccaa |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4311041 |
ctacgagtgtaactagaactagctgcaaaactgggtccgtccagctctttactcattcacaactgataacttatatgcaatatatgtaccaa |
4311132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University