View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13411_low_12 (Length: 253)
Name: NF13411_low_12
Description: NF13411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13411_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 35140273 - 35140507
Alignment:
| Q |
1 |
gcatttatggtttattgtccttttgtctttcatttgtctgtgatttagagaaggatgtaagcaactaagattccttaagatatgtctatggg-tatggca |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35140273 |
gcatttatggtttattgtccttttgtctttcatttgtctgtgatttagagaaggatgtaagcaactaagattccttaagatatgtctatgggctatggca |
35140372 |
T |
 |
| Q |
100 |
tgtggactggcattgctttgagaatgcaaaaccccacaaggttccagcatgatacaggcagnnnnnnnnccaacgtgctgtctttggattgagacatgaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35140373 |
tgtggactggcattgctttgagaatgcaaaaccccacaaggttccagcatgatacaggcag-aaaaaaaccaacgtgctgtctttggattgagacatgaa |
35140471 |
T |
 |
| Q |
200 |
cactcaacatcaatgttcgccaaacatgttcattct |
235 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35140472 |
caatcaacatcaatgttcgccaaacatgttcattct |
35140507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University