View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13412_low_2 (Length: 207)

Name: NF13412_low_2
Description: NF13412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13412_low_2
NF13412_low_2
[»] chr4 (1 HSPs)
chr4 (17-189)||(37392238-37392410)


Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 17 - 189
Target Start/End: Complemental strand, 37392410 - 37392238
Alignment:
17 aatatagccataaaaactaattggtgggcatgagtataggtcaaatcacttgtttcattggcaagacattagtataataatttaactggacatgcaggga 116  Q
    |||||| |||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37392410 aatataaccatcaaaactaattggtgggcatgagcataggtcaaatcacttgtttcattggcaagacattagtataataatttaactggacatgcaggga 37392311  T
117 gcaagcaagtggataactgattgtgattaataagtctaattggtggtttaaggctttaagcctttcatttcac 189  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
37392310 gcaagcaagtggataactgattgtgattaattagtctaattggtggtttaaggctttaagcctttcatttcac 37392238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University