View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13413_low_4 (Length: 250)
Name: NF13413_low_4
Description: NF13413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13413_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 3 - 238
Target Start/End: Original strand, 2621672 - 2621910
Alignment:
| Q |
3 |
attaatataaggaccgtatttttgtaaaattgatatttcaggtggatagtgctaacaagcatggt---gtcctactagatatgttacatgttttgacaga |
99 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2621672 |
attaatataaggaccatatttttgtaaaattgatatttcaggtggatagtgttaacaagcatggtggtgtcctactagatatgttacatgttttgacaga |
2621771 |
T |
 |
| Q |
100 |
catgaactttcaaatcatcaaaagttatatttcatcggatgctaattagtgattggtgcatggacggtgtgttttattaaatatcttagtagaatgttga |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2621772 |
catgaactttcaaatcatcaaaagttatatttcatcggatgctaattagtgattggtgcatggacggtgtgttttattaaatatcttagtagaatgttga |
2621871 |
T |
 |
| Q |
200 |
gttgagtgcaaggatcattctaggctcatgtttgatatt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2621872 |
gttgagtgcaaggatcattctaggctcatgtttgatatt |
2621910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University