View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13413_low_7 (Length: 229)
Name: NF13413_low_7
Description: NF13413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13413_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 31838315 - 31838528
Alignment:
| Q |
1 |
ataatgttttgcaagctaatcacggatgccgaagcagccaaaattggatcaagacaacgctgcggagttcctgctaaaccccctttgatcttcgctttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31838315 |
ataatgttttgcaagctaatcacggatgccgaagcagccaaaattggatcaagacaacgctgcggagttcctgctaaaccccctttgatcttcgctttga |
31838414 |
T |
 |
| Q |
101 |
agcttccatatcctgctaaaaattcacccggacacgacgcaacaacacctaagggatacagtgacgctaaatgcaatccaaaaatagcctcaacatcttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31838415 |
agcttccatatcctgctaaaaattcacccggacgcgacgcaacaacacctaagggatacagtgacgctaaatgcaatccaaaaatagcctcaacatcttc |
31838514 |
T |
 |
| Q |
201 |
aagcacatattctt |
214 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
31838515 |
aagcacattttctt |
31838528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 3 - 214
Target Start/End: Complemental strand, 26264804 - 26264593
Alignment:
| Q |
3 |
aatgttttgcaagctaatcacggatgccgaagcagccaaaattggatcaagacaacgctgcggagttcctgctaaaccccctttgatcttcgctttgaag |
102 |
Q |
| |
|
||||||||||||||||||||| || ||||| ||||||| |||||||||||| |||||||| || | |||||||||||||||||||| ||||||||| |
|
|
| T |
26264804 |
aatgttttgcaagctaatcaccgacattgaagcggccaaaacaggatcaagacaatgctgcggaatttccgctaaaccccctttgatctttgctttgaag |
26264705 |
T |
 |
| Q |
103 |
cttccatatcctgctaaaaattcacccggacacgacgcaacaacacctaagggatacagtgacgctaaatgcaatccaaaaatagcctcaacatcttcaa |
202 |
Q |
| |
|
|||||| ||||||||||||| || ||||| | || ||||||||||||||||||||| ||| ||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
26264704 |
cttccacatcctgctaaaaaatcccccggtcgtgatgcaacaacacctaagggatactgtgtcgctaaatgcaatccgaaaatagcctctacatcttcaa |
26264605 |
T |
 |
| Q |
203 |
gcacatattctt |
214 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
26264604 |
gcacattttctt |
26264593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University