View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13414_high_4 (Length: 236)
Name: NF13414_high_4
Description: NF13414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13414_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 40635466 - 40635238
Alignment:
| Q |
1 |
cgctgtagcccccaaaactgcatactcttcaaccaggaattttgcaaccactgataccacaacatcgactgcaacgccagcagccatgtgaa-------- |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40635466 |
cgctgtagcccccaaaactgcatactcttcaaccaggaattttgcaaccactgataccacaacatcgactgcaacgccagcagccatgtgaagtcttctc |
40635367 |
T |
|
| Q |
93 |
------ctctgcttaattaatttgtttatcttttggttttggttttccaaatgattaaggaactactcttcatgcttccaaccctcctttttgaatttta |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40635366 |
tgctagctctgcttaattaatttgtttatcttttggttttcgttttccaaatgattaaggaactactcttcatgcttccaaccctcctttttgaatttta |
40635267 |
T |
|
| Q |
187 |
tttgcacacacttttttgtatgataataa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40635266 |
tttgcacacacttttttgtatgataataa |
40635238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University