View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13414_high_5 (Length: 236)
Name: NF13414_high_5
Description: NF13414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13414_high_5 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 236
Target Start/End: Original strand, 19620514 - 19620732
Alignment:
| Q |
18 |
agggaacaagaacgaagaattggagacggtgtgattttgcaaattatgacggtgcaaatcacgaaattgatgagttgtgattctgaggagtgagttgcga |
117 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||| |||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
19620514 |
agggaacaagaacgaagaattggagacagtgtgattttgaaaattttgacggtgcaaatcgcgaaattgatgagttgtgatcataaggagtgagttgcga |
19620613 |
T |
 |
| Q |
118 |
ttatgagccagtatgattttgcaataaagaatgatggttcaacgatttaatgttaatgatttgagatgaggaatgaagatttcgtgattcagtgtagggt |
217 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19620614 |
ttatgagccagtatgattttgtaataaagaatgatgattcaacgatttaatgttaatgatttgcgatgaggaatgaagattccgtgattcagtgtagggt |
19620713 |
T |
 |
| Q |
218 |
gagagatagagggttaggg |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
19620714 |
gagagatagagggttaggg |
19620732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University