View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13417_low_5 (Length: 259)
Name: NF13417_low_5
Description: NF13417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13417_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 246
Target Start/End: Original strand, 36903302 - 36903530
Alignment:
| Q |
18 |
agtttttccttggagctcttctcaatttctgtctcgacaggttcgttcgttactctcacttcttcaaccatttctgctaaatcatcaaggaaaaataaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36903302 |
agtttttccttggagctcttctcaatttctgtctcgacaggttcgttcgttactctcacttcttcaaccatttctgctaaatcatcaaggaaaaataaaa |
36903401 |
T |
 |
| Q |
118 |
cataacctaattgttaaattttttaaaatcagggatgggagattgaatgcgatatcagaaatcgtagatgaattcaacgcgttggaacagaagatagttg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36903402 |
cataacctaattgttaaattttttaaaatcagggatgggagattgaatgcgatatcagaaatcgtagacgaattcaacgcgttggaacagaagatagttg |
36903501 |
T |
 |
| Q |
218 |
atattgaagataataagattgcacaggtt |
246 |
Q |
| |
|
| |||||||| ||||| ||| |||||||| |
|
|
| T |
36903502 |
agattgaagagaataatattacacaggtt |
36903530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 181 - 246
Target Start/End: Complemental strand, 17479601 - 17479536
Alignment:
| Q |
181 |
gtagatgaattcaacgcgttggaacagaagatagttgatattgaagataataagattgcacaggtt |
246 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| || ||| | || ||||||||| | |||||| |
|
|
| T |
17479601 |
gtagatgaattcaacgccttggaacagaagatagtggagattaaggagaataagattacgcaggtt |
17479536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 64
Target Start/End: Complemental strand, 17480353 - 17480321
Alignment:
| Q |
32 |
gctcttctcaatttctgtctcgacaggttcgtt |
64 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
17480353 |
gctcttctcaatttctgtctggacaggttcgtt |
17480321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University