View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13418_low_1 (Length: 587)
Name: NF13418_low_1
Description: NF13418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13418_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 84; Significance: 1e-39; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 359 - 482
Target Start/End: Original strand, 7461728 - 7461852
Alignment:
| Q |
359 |
gacccaccacatatgaacgtgcatatgagctctataggctcgaagagattaatccaagccgttcacattattaaagttctcatttttcagccac----at |
454 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |||||||||||||||||||| |||||||| || |
|
|
| T |
7461728 |
gacccaccacatatgaacgtgcatatgagctc--taggctcgaagaaattaatccaagccgttc-cattattaaagttctcatttctcagccacatggat |
7461824 |
T |
 |
| Q |
455 |
gatcattcatgtcatgtacattttcttt |
482 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
7461825 |
gatcattcatgtcatgtacattttcttt |
7461852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 192 - 305
Target Start/End: Original strand, 7461566 - 7461674
Alignment:
| Q |
192 |
attcactatattgttgttatgactttgtttaattaaaaaagttgtttgcttagtttaatcccctaaatgttgaaagagagaataagcactagcatgcaac |
291 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7461566 |
attcactatattgttgttat-----tgtttaattaaaaaagttgtttgcttagtttaataccctaaatgttgaaagagagaataggcactagcatgcaac |
7461660 |
T |
 |
| Q |
292 |
cagttcttcaggac |
305 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
7461661 |
gagttctttaggac |
7461674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 225 - 305
Target Start/End: Original strand, 7446593 - 7446676
Alignment:
| Q |
225 |
taaaaaagttgtttgcttagtttaatcccctaaa---tgttgaaagagagaataagcactagcatgcaaccagttcttcaggac |
305 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||| |||||||| || ||||||||||||||| |||||| ||||| |
|
|
| T |
7446593 |
taaaaaagttgtttgcttagtttaatccactaaatgttgttgatagagagaagaaacactagcatgcaaccggttctttaggac |
7446676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University