View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13418_low_7 (Length: 270)
Name: NF13418_low_7
Description: NF13418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13418_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 7 - 214
Target Start/End: Original strand, 24258714 - 24258921
Alignment:
| Q |
7 |
aaaagaagtgcatgtgagagttgttgaagagaaagttggtgagagtgaagttcactcaatgtgtgatgtgattatatgcttccttagaagggatctgaca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24258714 |
aaaagaagtgcatgtgagagttgttgaagagaaagttggtgagagtgaagttcactcaatatgtgaagtgattatatgcttccttagaagggatctgaca |
24258813 |
T |
 |
| Q |
107 |
ccgaaggtttagccgtctttaaaggattgtgtgttttgcgaggatcatgtaggtttggttttgctcatatacacaagaaaattaagggcaaggctcttaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24258814 |
ccgaaggtttagccgtctttaaaggattgtgtgttttgcgaggatcacgtaggtttggttttgctcatatacacaagaaaattaagggcaaagctcttaa |
24258913 |
T |
 |
| Q |
207 |
aaagagaa |
214 |
Q |
| |
|
|||||||| |
|
|
| T |
24258914 |
aaagagaa |
24258921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University