View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1341R-Insertion-17 (Length: 283)
Name: NF1341R-Insertion-17
Description: NF1341R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1341R-Insertion-17 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 13 - 283
Target Start/End: Complemental strand, 40390194 - 40389931
Alignment:
| Q |
13 |
atatgctctttcaaactatagaaaacttctatttcttggcattctctcattgttatttctctttttctatatctacccagtatcatgctataaaaagtag |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40390194 |
atatgctctttcaaactatagaaaacttctatttcttggtattctctcattgttatttctctttttctatatctacccaacatcatgctataaaaa---- |
40390099 |
T |
 |
| Q |
113 |
ctcttaattaataactgtcttggctttaggatacgttcaatcctctnnnnnnnngcatgctggtatgcatttgtgcaatctttgccaaatcctgagcctt |
212 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40390098 |
------agtaataactgtcttggctttaggatacgttcaatcctctaaaaaaaagcatgccggtatgcatttgtgcaatctttgccaaatcctgagcctt |
40390005 |
T |
 |
| Q |
213 |
gggcttttaaagctttccctgtctatgccatctagaaaa---tagctcttttggcatccatgctttactcgcac |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
40390004 |
gggcttttaaagctttccctgtctatgccatctagaaaatagtagctcttttggcatccatgctttgctcgcac |
40389931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University