View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1341R-Insertion-20 (Length: 198)
Name: NF1341R-Insertion-20
Description: NF1341R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1341R-Insertion-20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 9 - 193
Target Start/End: Original strand, 30293429 - 30293612
Alignment:
| Q |
9 |
atattgagcatgtttagtaacatcttgagaattatttagtgaagtctaccggttgaattaacatactgnnnnnnnnnnnnggattatttcgttatttatg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30293429 |
atattgagcatgtttagtaacatcttgagaattatttagtgaagtctactggttgaattaacatactgttttttt-----ggattatttcgttatttatg |
30293523 |
T |
 |
| Q |
109 |
ttgtcatgctttccacacattcaacttgctcttttgttagccacatca----cgttcatgtacgatgattaatttctctttttatataa |
193 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30293524 |
ttgccatgctttccacacattcaacttgctcttttgttacccacatcacgttcgttcatgtacgatgattgatttctctttttatataa |
30293612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University