View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1341R-Insertion-22 (Length: 165)
Name: NF1341R-Insertion-22
Description: NF1341R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1341R-Insertion-22 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 8 - 165
Target Start/End: Complemental strand, 38911226 - 38911071
Alignment:
| Q |
8 |
aaaaattagggcatcggaaaaattggctcaagacggagatagatttcgccgagggattgacaagttgtgactaagtgattctccgataagtacttaagcg |
107 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38911226 |
aaaaattagggcatcggaaaatt--gctcaagacggagatagatttcgccgagggattgacaagttgtgactaaatgattctccgataagtacttaagcg |
38911129 |
T |
|
| Q |
108 |
aaacttcgtagtcgattcggagccatttgagagctttaacgtattcacctctgttctt |
165 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38911128 |
aaatttcgtagtcgattcggagccatttgagagctttaacgtattcacctctgttctt |
38911071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University