View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1341R-Insertion-23 (Length: 142)
Name: NF1341R-Insertion-23
Description: NF1341R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1341R-Insertion-23 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 2e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 2e-68
Query Start/End: Original strand, 8 - 142
Target Start/End: Original strand, 44079602 - 44079736
Alignment:
| Q |
8 |
acaactttgattgtgccagagccattgtctttggcacaaaacacaaccttacactcatcgcgctccctcgccatatcaggaagcgggatccacatgtcat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44079602 |
acaactttgattgtgccagagccattgtctttggcacaaaacacaaccttacactcatcgcgctccctcgccatatcaggaagcgggatccacatgtcat |
44079701 |
T |
|
| Q |
108 |
ttaccacatcatacgcaaatgctgacttcaatgca |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
44079702 |
ctaccacatcatacgcaaatgctgacttcaatgca |
44079736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 2e-25
Query Start/End: Original strand, 8 - 138
Target Start/End: Original strand, 44074662 - 44074792
Alignment:
| Q |
8 |
acaactttgattgtgccagagccattgtctttggcacaaaacacaaccttacactcatcgcgctccctcgccatatcaggaagcgggatccacatgtcat |
107 |
Q |
| |
|
||||||||||| |||||| ||||||||| | |||||||||||| | ||||||||||| ||||||||| ||||||||||||||| || ||||| |||| |
|
|
| T |
44074662 |
acaactttgatcgtgccaaagccattgtttccagcacaaaacacagctttacactcatcacgctccctcaccatatcaggaagcgagacccacacatcat |
44074761 |
T |
|
| Q |
108 |
ttaccacatcatacgcaaatgctgacttcaa |
138 |
Q |
| |
|
|| |||| ||||||||||| ||||| ||||| |
|
|
| T |
44074762 |
ttgccacgtcatacgcaaacgctgatttcaa |
44074792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University