View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1341R-Insertion-24 (Length: 128)
Name: NF1341R-Insertion-24
Description: NF1341R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1341R-Insertion-24 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 5e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 9 - 128
Target Start/End: Complemental strand, 31820258 - 31820139
Alignment:
| Q |
9 |
ctttccattattattgcacaagatgttggcatgtatgacatcaatcttatgtttctccatcacataaaaaattgttgtcaacaagctcggcttcttagtt |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31820258 |
ctttgcattattattgcacaagatgttggcatgtatgacatcaatcttatgtttctccatcacataaaaaattgttgtcaacaagctcggcttcttagtt |
31820159 |
T |
|
| Q |
109 |
gtgtatacgcaaaattgtgc |
128 |
Q |
| |
|
||||||| |||||||||||| |
|
|
| T |
31820158 |
gtgtatatgcaaaattgtgc |
31820139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 7e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 7e-16
Query Start/End: Original strand, 11 - 128
Target Start/End: Original strand, 12079323 - 12079441
Alignment:
| Q |
11 |
ttccattattattgcacaagatgttgg-catgtatgacatcaatcttatgtttctccatcacataaaaaattgttgtcaacaagctcggcttcttagttg |
109 |
Q |
| |
|
||||||||| ||||| ||||||||||| ||| |||||| |||||||||||||||||||| |||||||| ||||| |||||| | || |||| |||| |
|
|
| T |
12079323 |
ttccattatcattgcgcaagatgttggacatatatgacttcaatcttatgtttctccattacataaaagattgtgatcaacatgtctggtctcttggttg |
12079422 |
T |
|
| Q |
110 |
tgtatacgcaaaattgtgc |
128 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
12079423 |
agtatatgcaaaattgtgc |
12079441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University