View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1341_high_7 (Length: 302)
Name: NF1341_high_7
Description: NF1341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1341_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 13 - 216
Target Start/End: Complemental strand, 9478587 - 9478383
Alignment:
| Q |
13 |
ttattgatatttgttgctgatatgtcatagaagagttcttttgttgcaccaaaggaagttaacaataccacttgaactggtgaggaggttgtta-tgatg |
111 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||| | |||||||||||| |||| |||||| |||||| ||||| |
|
|
| T |
9478587 |
ttattgatatttgttgctcatatgtcatagaagagttattttgttgcaccaaaggaggttgataataccacttgagctggagaggagattgttagtgatg |
9478488 |
T |
 |
| Q |
112 |
gagtataatatcgtgatattgctcctctattaaattccattcataaaaattcaaatgagatcgagaaaattgataattttcatgaagttttttgcagcaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||| ||||||| ||||| |||||||||||||||| |
|
|
| T |
9478487 |
gagtataatatcgtgatattgctcctctattaaattccattttcaaaaattcaaatgagattgaggaaactgataatattcattaagttttttgcagcaa |
9478388 |
T |
 |
| Q |
212 |
caact |
216 |
Q |
| |
|
||||| |
|
|
| T |
9478387 |
caact |
9478383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University