View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1341_low_12 (Length: 305)

Name: NF1341_low_12
Description: NF1341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1341_low_12
NF1341_low_12
[»] chr3 (1 HSPs)
chr3 (77-169)||(394380-394472)


Alignment Details
Target: chr3 (Bit Score: 81; Significance: 4e-38; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 77 - 169
Target Start/End: Complemental strand, 394472 - 394380
Alignment:
77 agcagaacctgtgagacacaaccaaccactaagagttagagatcctagtatctcccttccctaaccaataataaaaataacctgattgtttac 169  Q
    |||||||  ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
394472 agcagaaagtgtgagacacaaccaaccactaagaattagagatcctagtatctcccttccctaaccaataataaaaataacctgattgtttac 394380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University