View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1341_low_13 (Length: 302)

Name: NF1341_low_13
Description: NF1341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1341_low_13
NF1341_low_13
[»] chr8 (1 HSPs)
chr8 (13-216)||(9478383-9478587)


Alignment Details
Target: chr8 (Bit Score: 133; Significance: 4e-69; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 13 - 216
Target Start/End: Complemental strand, 9478587 - 9478383
Alignment:
13 ttattgatatttgttgctgatatgtcatagaagagttcttttgttgcaccaaaggaagttaacaataccacttgaactggtgaggaggttgtta-tgatg 111  Q
    |||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||| | |||||||||||| |||| |||||| |||||| |||||    
9478587 ttattgatatttgttgctcatatgtcatagaagagttattttgttgcaccaaaggaggttgataataccacttgagctggagaggagattgttagtgatg 9478488  T
112 gagtataatatcgtgatattgctcctctattaaattccattcataaaaattcaaatgagatcgagaaaattgataattttcatgaagttttttgcagcaa 211  Q
    |||||||||||||||||||||||||||||||||||||||||   ||||||||||||||||| ||| ||| ||||||| ||||| ||||||||||||||||    
9478487 gagtataatatcgtgatattgctcctctattaaattccattttcaaaaattcaaatgagattgaggaaactgataatattcattaagttttttgcagcaa 9478388  T
212 caact 216  Q
    |||||    
9478387 caact 9478383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University