View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1341_low_24 (Length: 251)
Name: NF1341_low_24
Description: NF1341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1341_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 27 - 236
Target Start/End: Complemental strand, 13365180 - 13364971
Alignment:
| Q |
27 |
aaagcttccttcaatgaagccgctttcgaggcggagcggctcaccctcgacgcagaagctcgtcgagcaatggcggttgaggaggagaaatcttcgatgc |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13365180 |
aaagcttccttcaatgaagccgctttcgaggcggagcggctcaccctcgacgctgaagctcgtcgagcaatggcggttgaggaggagaaatcttcgatgc |
13365081 |
T |
 |
| Q |
127 |
aggatgatccgaaagcttggaaatgggtaattagaaagaggatatgggatttgatggaagggaataattttgctcagaatcctagacctgttcatcatag |
226 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13365080 |
aggatgatccaaaagcttggaaatgggtgattagaaagaggatatgggatttgatggaagggaataattttgctcagaatcctagacctgttcatcatag |
13364981 |
T |
 |
| Q |
227 |
gattcctaat |
236 |
Q |
| |
|
|||||||||| |
|
|
| T |
13364980 |
gattcctaat |
13364971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 152
Target Start/End: Original strand, 13326882 - 13326924
Alignment:
| Q |
110 |
ggagaaatcttcgatgcaggatgatccgaaagcttggaaatgg |
152 |
Q |
| |
|
||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
13326882 |
ggagaaatctttgaagcaggatcatccgaaagcttggaaatgg |
13326924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University