View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1341_low_26 (Length: 237)
Name: NF1341_low_26
Description: NF1341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1341_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 100 - 165
Target Start/End: Original strand, 53834737 - 53834802
Alignment:
| Q |
100 |
tggacaagacatgcccataaccacattggggcagcgatgatctaaccttgttaaatattattcgac |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
53834737 |
tggacaagacatgcccataaccacattgggacagcgatgatctaaccttgttaaataatattcgac |
53834802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University