View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1341_low_5 (Length: 445)
Name: NF1341_low_5
Description: NF1341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1341_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 3e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 3e-95
Query Start/End: Original strand, 72 - 264
Target Start/End: Original strand, 54655788 - 54655980
Alignment:
| Q |
72 |
ctgttcactttaactattaaatcctcaagagtcatattgttgtttgtttggtatagcaactctaagaacacgtgagtgaaataagaaaccaccaaacttt |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54655788 |
ctgttcactttaactattaaatcctcaagagtcatattgccgtttgtttggtataacaactctaagaacacgtgagtgaaataagaaaccaccaaacttt |
54655887 |
T |
|
| Q |
172 |
tagtatcactagcatcaaccttgccataatatgactcttgataactttgacatgccgctattaggatgcctcttggaggttttgtcacatcca |
264 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54655888 |
taatatcactagcatcaaccttgccataatatgactcttgataactttgacatgccgctattaggatgcctcttggaggttttgtcacatcca |
54655980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 358 - 399
Target Start/End: Original strand, 54656095 - 54656136
Alignment:
| Q |
358 |
ggttgatagctatttcccacaacctcatgtgatcccttcatc |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54656095 |
ggttgatagctatttcccacaacctcatgtgatcccttcatc |
54656136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University