View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13420_high_14 (Length: 247)
Name: NF13420_high_14
Description: NF13420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13420_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 1487736 - 1487493
Alignment:
| Q |
1 |
aaataaaccaaaaacggttgaaaaccccaaaaacttctacggatagttcacaaactgaacttgacagttcgattctttttggtacagtttggttcgcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1487736 |
aaataaaccaaaaacggttgaaaaccccaaaaacttctacggatagttcacaaactgaacttgacagttcgattctttttggtacagtttggttcgcttt |
1487637 |
T |
 |
| Q |
101 |
tacggatcaattgnnnnnnnnnnnnnnnnnattaagacccaggttacaggcaaatgcggttgttgtggctgaaattgtggtcaagatacagtcacataag |
200 |
Q |
| |
|
||||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1487636 |
tacggatcaattgttttttgtttttgttttattaagacccaagttactggcaaatgcggttgttgtggctgaaattgtggtcaagatacagtcacataag |
1487537 |
T |
 |
| Q |
201 |
aatttgatataatgatatgttatattattatttcatctcagtcg |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1487536 |
aatttgatataatgatatgttatattattatttcatcacagtcg |
1487493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University