View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13420_high_15 (Length: 232)
Name: NF13420_high_15
Description: NF13420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13420_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 1487715 - 1487935
Alignment:
| Q |
1 |
ttcaaccgtttttggtttatttaatagttctaatatcagctaataatagctttgtataatgttcagttttctgtaaagatagttaagtttgaacccttaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1487715 |
ttcaaccgtttttggtttatttaatagttctaatatcagctaataatagctttgtgtaatgttcagttttctgtaaagatagttaagtttgaacccttaa |
1487814 |
T |
 |
| Q |
101 |
cagttccgttcagtttaattgttatatggttcggtctggttttcctttttgaaacgaaccatggacaatcctatttgtaatatcaagaattgcaacacaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1487815 |
cagttccgttcagtttaattgttatatggttcggtctggttttcctttttgaaacgaaccatggacaatcctatttgtaatatcaaggattgcaacacaa |
1487914 |
T |
 |
| Q |
201 |
gtatgaccataaccataattt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1487915 |
gtatgaccataaccataattt |
1487935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University