View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13420_low_16 (Length: 253)

Name: NF13420_low_16
Description: NF13420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13420_low_16
NF13420_low_16
[»] chr4 (2 HSPs)
chr4 (152-247)||(50632529-50632624)
chr4 (17-77)||(50632361-50632421)


Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 152 - 247
Target Start/End: Original strand, 50632529 - 50632624
Alignment:
152 attattgttgtcacatgtaagttgtttgttgctttttgtaaccatgggctttgagtcgacatggtgattttaaggttaaaccccctttcatctcac 247  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||    
50632529 attattgttgtcacatgtaagttgtttgttgctttttgtaaccatgggctttgagtcgacatagtgattttaaggttaaaccccctttcatgtcac 50632624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 17 - 77
Target Start/End: Original strand, 50632361 - 50632421
Alignment:
17 atgaatgaatgaccaatgttttcacttggctgctatttaaggtagtttggtcggtgagcta 77  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50632361 atgaatgaatgaccaatgttttcacttggctgctatttaaggtagtttggtcggtgagcta 50632421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University