View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13421_high_11 (Length: 311)
Name: NF13421_high_11
Description: NF13421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13421_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 2e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 18 - 178
Target Start/End: Complemental strand, 42240150 - 42239990
Alignment:
| Q |
18 |
gtgattacattgatggaagggtaagaaatgaattgaagaggaccaacaacaaggaagaacattttcaagacatatttatagcaattaagcatttcatggg |
117 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
42240150 |
gtgattaccttgatggaagggtaagaaatgagttgaagaggaccaacaacaaggaagaacattttcaggacatctttatagcaattaagcatttcatgga |
42240051 |
T |
 |
| Q |
118 |
gagataaacgaactttgggttggatcttgtactcatagaaggggtataagcgtttgatttc |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42240050 |
gagataaacgaactttgggttggatcttgtactcatcgaaggggtataagcgtttgatttc |
42239990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University