View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13421_high_12 (Length: 252)
Name: NF13421_high_12
Description: NF13421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13421_high_12 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 15 - 252
Target Start/End: Complemental strand, 37941658 - 37941421
Alignment:
| Q |
15 |
aatatatacaacatgcacagccaaaaccaagctttcacctttcgaacaattcatgatcaaacaccacaaaagccactgcaaaagtaccctcttggttatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37941658 |
aatatatacaacatgcacagccaaaaccaagctttcacctttcgaacaattcatgatcaaacaccacaaaagccactgcaaaagtaccctcttggttatt |
37941559 |
T |
 |
| Q |
115 |
cttctgctcttgtctcaaaaacacaagtaccatctttggaaattccgccaagtactgattctcatctcaaaatgggtaatgtcttggaggaattaggaat |
214 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37941558 |
cttcagctcttgtctcaaaaacacaagtaccatctttggaaattccgccaagtactgattctcatctcaaaatgggtaatgtcttggaggaattaggaat |
37941459 |
T |
 |
| Q |
215 |
attgaggcatgatgatcgtgttaacttgatgagtagta |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37941458 |
attgaggcatgatgatcgtgttaacttgatgagtagta |
37941421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University