View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13421_high_14 (Length: 231)
Name: NF13421_high_14
Description: NF13421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13421_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 75 - 197
Target Start/End: Original strand, 14281672 - 14281794
Alignment:
| Q |
75 |
ttagggttggaacagaagattgctatcttctcggcatgctggacatccccgacatgctgtcatcttctttaccaatgttgcttttgaggtaacaaactgc |
174 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14281672 |
ttaggggtggaacagaagattgctatcttctcggcatgctggacatccccgacatgctgtcatcttctttaccaatgttgcttttgaggtaacaaactgc |
14281771 |
T |
|
| Q |
175 |
ttcttgttatctcagagctactt |
197 |
Q |
| |
|
||||||||| ||||||||||||| |
|
|
| T |
14281772 |
ttcttgttagctcagagctactt |
14281794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University