View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13421_high_2 (Length: 470)
Name: NF13421_high_2
Description: NF13421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13421_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 429; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 429; E-Value: 0
Query Start/End: Original strand, 7 - 455
Target Start/End: Complemental strand, 5345385 - 5344937
Alignment:
| Q |
7 |
atcactttacagggtaaagattgccctcgtttataaacatttattcaggtcatctcttaaccgatgtgagacattaacgaaccttgatgtgatgtagcaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5345385 |
atcactttacagggtaaagattgccctcgtttataaacatttattcaggtcatctcttaaccgatgtgaaacattaacgaaccttgatgtgatgtagcaa |
5345286 |
T |
|
| Q |
107 |
ctacacttaatccttggttcataacaagattatgaaaaaggcttctctattataattttgacaacaatgtgaagatttttatggtccttgctgcatcata |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5345285 |
ctacacttaatccttggttcataacaagattatgaaaaaggcttctctattataattttgacaacaatgtgaagatttttatggtccttgctgcatcata |
5345186 |
T |
|
| Q |
207 |
ttgttacagctgtaattgcagctgtatcatattggattgcaattttctgcaatttcatttgaaaacatagttatgagttgattctaacatcaagcatagt |
306 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5345185 |
ttgttacagctgtaattgcagttgtatcatattggattgcaattttctgcaatttcatttgaaaacatagttatgagttgattctaacatcaagcatagt |
5345086 |
T |
|
| Q |
307 |
cgagacttgataatttccctcaaaacttgagttttttgaaatcatacaagtattttatatgaacctttcaagtatatattcaactaaacacacttttttg |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5345085 |
cgagacttgataatttccctcaaaacttgagttttttgaaatcatacaagtattttatatgaacctttcaagtatatattcaactaaacacacttttttg |
5344986 |
T |
|
| Q |
407 |
ttgccaactaatcagatttgactggtacaacaacaccaattgcagaaag |
455 |
Q |
| |
|
|||| |||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5344985 |
ttgctaactgatcagatttggctggtacaacaacaccaattgcagaaag |
5344937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 37 - 81
Target Start/End: Original strand, 33702283 - 33702327
Alignment:
| Q |
37 |
ttataaacatttattcaggtcatctcttaaccgatgtgagacatt |
81 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
33702283 |
ttataaacatttattcatgtcatctctcaaccgatgtgagacatt |
33702327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University